Transcript: Mouse XM_006517548.2

PREDICTED: Mus musculus microtubule-associated protein 1B (Map1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map1b (17755)
Length:
8417
CDS:
539..7555

Additional Resources:

NCBI RefSeq record:
XM_006517548.2
NBCI Gene record:
Map1b (17755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313614 ACGGGCTTCATACCCATAAAG pLKO_005 4532 CDS 100% 13.200 18.480 N Map1b n/a
2 TRCN0000091918 CCCACAATAGATTTCGAGTTA pLKO.1 7756 3UTR 100% 4.950 6.930 N Map1b n/a
3 TRCN0000091921 CGGATTCAACATGCTCATCAA pLKO.1 994 CDS 100% 4.950 6.930 N Map1b n/a
4 TRCN0000317172 CGGATTCAACATGCTCATCAA pLKO_005 994 CDS 100% 4.950 6.930 N Map1b n/a
5 TRCN0000313567 ACGTCCATTCATCCAATTAAG pLKO_005 7632 3UTR 100% 13.200 10.560 N Map1b n/a
6 TRCN0000091919 GCCGAGTTAGACATCAAAGAT pLKO.1 3860 CDS 100% 5.625 4.500 N Map1b n/a
7 TRCN0000317174 GCCGAGTTAGACATCAAAGAT pLKO_005 3860 CDS 100% 5.625 4.500 N Map1b n/a
8 TRCN0000091920 CCCAGAGAGATGTCCTTATAT pLKO.1 5414 CDS 100% 15.000 10.500 N Map1b n/a
9 TRCN0000091922 GCCCAAGAAAGAAGTGGTTAA pLKO.1 2119 CDS 100% 10.800 7.560 N Map1b n/a
10 TRCN0000317173 GCCCAAGAAAGAAGTGGTTAA pLKO_005 2119 CDS 100% 10.800 7.560 N Map1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.