Transcript: Mouse XM_006517713.2

PREDICTED: Mus musculus metaxin 3 (Mtx3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtx3 (382793)
Length:
1764
CDS:
45..677

Additional Resources:

NCBI RefSeq record:
XM_006517713.2
NBCI Gene record:
Mtx3 (382793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346665 TGCCTAAATCTCCTATCAAAC pLKO_005 570 CDS 100% 10.800 15.120 N Mtx3 n/a
2 TRCN0000346664 GAAGTGGAAGCACAGATATAT pLKO_005 534 CDS 100% 15.000 10.500 N Mtx3 n/a
3 TRCN0000346721 TAAATAAGGAGTCCAACTTAA pLKO_005 1736 3UTR 100% 13.200 7.920 N Mtx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14480 pDONR223 100% 63.7% 8.8% None (many diffs) n/a
2 ccsbBroad304_14480 pLX_304 0% 63.7% 8.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV