Transcript: Mouse XM_006517718.3

PREDICTED: Mus musculus poly (ADP-ribose) polymerase family, member 8 (Parp8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Parp8 (52552)
Length:
7663
CDS:
520..3315

Additional Resources:

NCBI RefSeq record:
XM_006517718.3
NBCI Gene record:
Parp8 (52552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517718.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238096 CCGATGTCCAGCATATCATTT pLKO_005 2953 CDS 100% 13.200 18.480 N Parp8 n/a
2 TRCN0000238094 GGGTTATGGAATCTAGTAAAT pLKO_005 3510 3UTR 100% 13.200 18.480 N Parp8 n/a
3 TRCN0000238095 TTCGGGAGCACCTTCGCATTT pLKO_005 2818 CDS 100% 10.800 15.120 N Parp8 n/a
4 TRCN0000238097 GATTAGAACAGAACCTATTAT pLKO_005 1362 CDS 100% 15.000 12.000 N Parp8 n/a
5 TRCN0000296222 TAACCCTTTGAATACTGATTT pLKO_005 3419 3UTR 100% 13.200 10.560 N PARP8 n/a
6 TRCN0000053226 GCAGTTTCTCTCAGGGAATAT pLKO.1 1261 CDS 100% 13.200 9.240 N PARP8 n/a
7 TRCN0000289216 GCAGTTTCTCTCAGGGAATAT pLKO_005 1261 CDS 100% 13.200 9.240 N PARP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517718.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.