Transcript: Mouse XM_006518107.1

PREDICTED: Mus musculus RIKEN cDNA 4930452B06 gene (4930452B06Rik), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930452B06Rik (74430)
Length:
2204
CDS:
120..1769

Additional Resources:

NCBI RefSeq record:
XM_006518107.1
NBCI Gene record:
4930452B06Rik (74430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178503 CAAATACTACGAGTTGGTCTA pLKO.1 1748 CDS 100% 4.050 5.670 N 4930452B06Rik n/a
2 TRCN0000176540 CCGCCAAACTGAAATTAAATT pLKO.1 380 CDS 100% 15.000 12.000 N 4930452B06Rik n/a
3 TRCN0000198811 CCAGTCCTCTAAGTCTCATTT pLKO.1 1998 3UTR 100% 13.200 9.240 N 4930452B06Rik n/a
4 TRCN0000181774 GCCGTCACTATCAGAAAGAAA pLKO.1 1513 CDS 100% 5.625 3.938 N 4930452B06Rik n/a
5 TRCN0000182055 CCATTTACTCTGGACACACAA pLKO.1 1203 CDS 100% 4.950 3.465 N 4930452B06Rik n/a
6 TRCN0000178583 CCTCTAAGTCTCATTTCGTAT pLKO.1 2003 3UTR 100% 4.950 3.465 N 4930452B06Rik n/a
7 TRCN0000198556 GAACAACCAGATGAGTGGATA pLKO.1 954 CDS 100% 4.950 3.465 N 4930452B06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.