Transcript: Mouse XM_006518436.3

PREDICTED: Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) (Chrna2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chrna2 (110902)
Length:
3795
CDS:
388..1926

Additional Resources:

NCBI RefSeq record:
XM_006518436.3
NBCI Gene record:
Chrna2 (110902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102910 CCACTCAACATGACAACTATT pLKO.1 2125 3UTR 100% 13.200 18.480 N Chrna2 n/a
2 TRCN0000414894 CATCGTGCGCTTTGGACTATC pLKO_005 570 CDS 100% 10.800 15.120 N Chrna2 n/a
3 TRCN0000102911 CGGAACCTATAACAGCAAGAA pLKO.1 1029 CDS 100% 4.950 6.930 N Chrna2 n/a
4 TRCN0000102913 GCTGTTCATTATCGTCTGCTT pLKO.1 1854 CDS 100% 2.640 3.696 N Chrna2 n/a
5 TRCN0000102912 GCTGCTCATCACAGAAATTAT pLKO.1 1251 CDS 100% 15.000 10.500 N Chrna2 n/a
6 TRCN0000422311 GGAGCCATCTCTAGAATATTC pLKO_005 1990 3UTR 100% 13.200 9.240 N Chrna2 n/a
7 TRCN0000102914 CCCAGACATTGTTCTCTACAA pLKO.1 744 CDS 100% 4.950 3.465 N Chrna2 n/a
8 TRCN0000061043 CGACCAGCAGAACTGCAAGAT pLKO.1 894 CDS 100% 4.950 3.465 N CHRNA2 n/a
9 TRCN0000437931 ACCTCTTTGGAGGCTACAATC pLKO_005 512 CDS 100% 10.800 6.480 N Chrna2 n/a
10 TRCN0000434193 AGGAGGAGGAAGAAGATGAAG pLKO_005 1577 CDS 100% 4.950 2.475 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.