Transcript: Mouse XM_006518502.3

PREDICTED: Mus musculus calpain 7 (Capn7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Capn7 (12339)
Length:
3180
CDS:
269..2215

Additional Resources:

NCBI RefSeq record:
XM_006518502.3
NBCI Gene record:
Capn7 (12339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030692 CCAACAATCCTACAATGATAT pLKO.1 576 CDS 100% 13.200 9.240 N Capn7 n/a
2 TRCN0000308843 CCAACAATCCTACAATGATAT pLKO_005 576 CDS 100% 13.200 9.240 N Capn7 n/a
3 TRCN0000030693 CCCATCTACCAATTCCATATA pLKO.1 1916 CDS 100% 13.200 9.240 N Capn7 n/a
4 TRCN0000308759 CCCATCTACCAATTCCATATA pLKO_005 1916 CDS 100% 13.200 9.240 N Capn7 n/a
5 TRCN0000030690 CCAGACGTTCAGTAAGGATAA pLKO.1 1015 CDS 100% 10.800 7.560 N Capn7 n/a
6 TRCN0000308760 CCAGACGTTCAGTAAGGATAA pLKO_005 1015 CDS 100% 10.800 7.560 N Capn7 n/a
7 TRCN0000030691 CCTCCATACATTGATGGGATT pLKO.1 1646 CDS 100% 4.050 2.835 N Capn7 n/a
8 TRCN0000030689 CCTCATTACTTGACTAAGATA pLKO.1 1679 CDS 100% 5.625 3.375 N Capn7 n/a
9 TRCN0000308762 CCTCATTACTTGACTAAGATA pLKO_005 1679 CDS 100% 5.625 3.375 N Capn7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.