Transcript: Mouse XM_006518813.1

PREDICTED: Mus musculus Sec24 related gene family, member C (S. cerevisiae) (Sec24c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec24c (218811)
Length:
4559
CDS:
133..3498

Additional Resources:

NCBI RefSeq record:
XM_006518813.1
NBCI Gene record:
Sec24c (218811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295423 ATTCGATGCACATCCTATAAT pLKO_005 1327 CDS 100% 15.000 21.000 N Sec24c n/a
2 TRCN0000381761 GCCTAAGCAGTGGCGATATAT pLKO_005 3134 CDS 100% 15.000 21.000 N Sec24c n/a
3 TRCN0000100581 GCGCTTTCTATATGAGCAATA pLKO.1 2510 CDS 100% 10.800 15.120 N Sec24c n/a
4 TRCN0000287928 GCGCTTTCTATATGAGCAATA pLKO_005 2510 CDS 100% 10.800 15.120 N Sec24c n/a
5 TRCN0000295421 TTGGCTTTGTCACCTATAATA pLKO_005 1847 CDS 100% 15.000 10.500 N Sec24c n/a
6 TRCN0000381760 AGTTTGGCCAAGGTGATATAC pLKO_005 386 CDS 100% 13.200 9.240 N Sec24c n/a
7 TRCN0000381332 GCTAAAGCAAGTGGGTAAATG pLKO_005 3494 CDS 100% 13.200 9.240 N SEC24C n/a
8 TRCN0000100580 CCTCTTGTAATGAATGTAGTT pLKO.1 3742 3UTR 100% 4.950 3.465 N Sec24c n/a
9 TRCN0000100583 GCGATATATATTTGCTGGAAA pLKO.1 3146 CDS 100% 4.950 3.465 N Sec24c n/a
10 TRCN0000295358 GACAGTTCCATATCGTATAAG pLKO_005 3570 3UTR 100% 13.200 7.920 N Sec24c n/a
11 TRCN0000100584 CCACCTTTAGTCACCACCAAT pLKO.1 1267 CDS 100% 4.950 2.970 N Sec24c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.