Transcript: Mouse XM_006518854.1

PREDICTED: Mus musculus zinc finger, MYM-type 5 (Zmym5), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zmym5 (219105)
Length:
5744
CDS:
695..2578

Additional Resources:

NCBI RefSeq record:
XM_006518854.1
NBCI Gene record:
Zmym5 (219105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113542 CGTACTCGAAAGACACGGAAT pLKO.1 1439 CDS 100% 4.050 5.670 N Zmym5 n/a
2 TRCN0000348745 GCACATCAACAATAGTGTTAA pLKO_005 2470 CDS 100% 13.200 10.560 N Zmym5 n/a
3 TRCN0000113544 CTCCAGCAATACCTAATGAAA pLKO.1 825 CDS 100% 5.625 4.500 N Zmym5 n/a
4 TRCN0000113540 GCCAGAATTGTGCTGACGAAT pLKO.1 1815 CDS 100% 4.950 3.960 N Zmym5 n/a
5 TRCN0000348671 CAACAGCTGTTTGTTATTAAA pLKO_005 3071 3UTR 100% 15.000 10.500 N Zmym5 n/a
6 TRCN0000113541 GCGTTTCAGAATGGAAGATTT pLKO.1 1151 CDS 100% 13.200 9.240 N Zmym5 n/a
7 TRCN0000348669 GTGCAGCTACTGTACACATAA pLKO_005 2558 CDS 100% 13.200 9.240 N Zmym5 n/a
8 TRCN0000348670 AGGAATTGGATATGTCCATTT pLKO_005 2118 CDS 100% 10.800 7.560 N Zmym5 n/a
9 TRCN0000113543 GCTCCAGCAATACCTAATGAA pLKO.1 824 CDS 100% 5.625 3.938 N Zmym5 n/a
10 TRCN0000335696 GCTCCAGCAATACCTAATGAA pLKO_005 824 CDS 100% 5.625 3.938 N Zmym5 n/a
11 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5473 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.