Transcript: Mouse XM_006518899.3

PREDICTED: Mus musculus A kinase (PRKA) anchor protein 11 (Akap11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akap11 (219181)
Length:
9387
CDS:
173..5857

Additional Resources:

NCBI RefSeq record:
XM_006518899.3
NBCI Gene record:
Akap11 (219181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241708 ACCCGCAATTAAGGATTATTC pLKO_005 5589 CDS 100% 13.200 18.480 N Akap11 n/a
2 TRCN0000241710 TGAGTATGCAGGGCATGTTAT pLKO_005 4162 CDS 100% 13.200 10.560 N Akap11 n/a
3 TRCN0000241709 AGTTTGGGCAGTGCGTTTAAA pLKO_005 1838 CDS 100% 15.000 10.500 N Akap11 n/a
4 TRCN0000241707 GCAGTTATCAAAGTCTATTAT pLKO_005 2968 CDS 100% 15.000 10.500 N Akap11 n/a
5 TRCN0000241711 GTATGGTTTGGATACTATTTA pLKO_005 8975 3UTR 100% 15.000 10.500 N Akap11 n/a
6 TRCN0000001919 GTTGGTAGTTTGTCTGAGAAT pLKO.1 3584 CDS 100% 4.950 3.465 N AKAP11 n/a
7 TRCN0000297340 GTTGGTAGTTTGTCTGAGAAT pLKO_005 3584 CDS 100% 4.950 3.465 N AKAP11 n/a
8 TRCN0000001916 GCTGAGAAGATAGTTGCTGAA pLKO.1 5072 CDS 100% 4.050 2.835 N AKAP11 n/a
9 TRCN0000279896 GCTGAGAAGATAGTTGCTGAA pLKO_005 5072 CDS 100% 4.050 2.835 N AKAP11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.