Transcript: Mouse XM_006518915.2

PREDICTED: Mus musculus FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) (Farp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Farp1 (223254)
Length:
4573
CDS:
104..3220

Additional Resources:

NCBI RefSeq record:
XM_006518915.2
NBCI Gene record:
Farp1 (223254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251727 ACGGCATCTAATCAGTTTAAA pLKO_005 2462 CDS 100% 15.000 21.000 N Farp1 n/a
2 TRCN0000251725 ACCGAAGCACGTCGTTGTTAA pLKO_005 424 CDS 100% 13.200 18.480 N Farp1 n/a
3 TRCN0000196006 CCGAAGCACGTCGTTGTTAAA pLKO.1 425 CDS 100% 13.200 18.480 N Farp1 n/a
4 TRCN0000251726 CCTGACGTGAATAGCTCATAC pLKO_005 947 CDS 100% 10.800 15.120 N Farp1 n/a
5 TRCN0000216461 GCTGTTTGTGATTCCTATTTA pLKO.1 3794 3UTR 100% 15.000 12.000 N Farp1 n/a
6 TRCN0000251724 CACCGGCTCATGCACTATAAG pLKO_005 2141 CDS 100% 13.200 10.560 N Farp1 n/a
7 TRCN0000183277 GCACAAGTTCCATACCAATTT pLKO.1 1852 CDS 100% 13.200 10.560 N Farp1 n/a
8 TRCN0000184111 CCGAGACTTCTGCAAGTCTTT pLKO.1 997 CDS 100% 0.495 0.396 N Farp1 n/a
9 TRCN0000251728 TGCTGTTTCCCAAACGGATTT pLKO_005 3560 3UTR 100% 10.800 7.560 N Farp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.