Transcript: Mouse XM_006518975.3

PREDICTED: Mus musculus cadherin-like 24 (Cdh24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh24 (239096)
Length:
2563
CDS:
965..2425

Additional Resources:

NCBI RefSeq record:
XM_006518975.3
NBCI Gene record:
Cdh24 (239096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518975.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094813 CGCTCTTACACCTTCCGTGTA pLKO.1 1958 CDS 100% 0.405 0.567 N Cdh24 n/a
2 TRCN0000094810 CCCATCGGAGTTCATCATCAA pLKO.1 1360 CDS 100% 4.950 3.960 N Cdh24 n/a
3 TRCN0000436415 CAAGTTCCCTCAGAGTCTATA pLKO_005 1735 CDS 100% 13.200 9.240 N Cdh24 n/a
4 TRCN0000430441 CTTTGTCATTGAGGAATATTC pLKO_005 1117 CDS 100% 13.200 9.240 N Cdh24 n/a
5 TRCN0000364932 ATGAGGCCACAGGCAATATTC pLKO_005 1248 CDS 100% 13.200 9.240 N CDH24 n/a
6 TRCN0000364935 TCTTTGTCATTGAGGAATATG pLKO_005 1116 CDS 100% 13.200 9.240 N CDH24 n/a
7 TRCN0000054252 CTTCAGCATCAGCACAGACTT pLKO.1 1882 CDS 100% 4.950 3.465 N CDH24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518975.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.