Transcript: Mouse XM_006519052.3

PREDICTED: Mus musculus leucine rich repeat containing 16B (Lrrc16b), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Carmil3 (268747)
Length:
4886
CDS:
429..4559

Additional Resources:

NCBI RefSeq record:
XM_006519052.3
NBCI Gene record:
Carmil3 (268747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099553 CGCACCAGCATCCTTATCAAT pLKO.1 2097 CDS 100% 5.625 7.875 N Carmil3 n/a
2 TRCN0000099554 CGCCTTATTCCCAGAGAGAAT pLKO.1 4187 CDS 100% 4.950 6.930 N Carmil3 n/a
3 TRCN0000168801 GAACTTCAATGTCAAGGCCAA pLKO.1 1979 CDS 100% 2.160 3.024 N CARMIL3 n/a
4 TRCN0000099552 GCCAGCCTTCAAGCAATTCTT pLKO.1 1664 CDS 100% 5.625 3.938 N Carmil3 n/a
5 TRCN0000099550 CAGCAGCACTAAGAAGGCATA pLKO.1 4666 3UTR 100% 4.050 2.835 N Carmil3 n/a
6 TRCN0000099551 GCTATAAACTAAGGCATCAAA pLKO.1 3328 CDS 100% 5.625 3.375 N Carmil3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.