Transcript: Mouse XM_006519120.3

PREDICTED: Mus musculus excision repair cross-complementing rodent repair deficiency, complementation group 6 (Ercc6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ercc6 (319955)
Length:
8657
CDS:
324..4769

Additional Resources:

NCBI RefSeq record:
XM_006519120.3
NBCI Gene record:
Ercc6 (319955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173450 CGAGCAAGAAACCACATGATT pLKO.1 4464 CDS 100% 5.625 4.500 N Ercc6 n/a
2 TRCN0000194536 GAGCAGCGATGATTATGTGTT pLKO.1 4031 CDS 100% 4.950 3.465 N Ercc6 n/a
3 TRCN0000173630 GCATCCTTCATCACTAACAGA pLKO.1 4322 CDS 100% 3.000 2.100 N Ercc6 n/a
4 TRCN0000173411 GAGGAACTTCATTGCTTTCCA pLKO.1 4580 CDS 100% 3.000 1.800 N Ercc6 n/a
5 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 5789 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.