Transcript: Mouse XM_006519171.4

PREDICTED: Mus musculus diacylglycerol kinase, eta (Dgkh), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dgkh (380921)
Length:
21027
CDS:
14793..18035

Additional Resources:

NCBI RefSeq record:
XM_006519171.4
NBCI Gene record:
Dgkh (380921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363025 ATGAACGGAGGGCCTTATTTA pLKO_005 15480 CDS 100% 15.000 12.000 N Dgkh n/a
2 TRCN0000363028 ATGAGCATGCGGTGGTCATAT pLKO_005 15892 CDS 100% 13.200 10.560 N Dgkh n/a
3 TRCN0000363026 CAACGTCAAGGCGCTCTATAA pLKO_005 17525 CDS 100% 13.200 9.240 N Dgkh n/a
4 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6106 5UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.