Transcript: Mouse XM_006519308.3

PREDICTED: Mus musculus apoptotic chromatin condensation inducer 1 (Acin1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acin1 (56215)
Length:
2354
CDS:
129..1787

Additional Resources:

NCBI RefSeq record:
XM_006519308.3
NBCI Gene record:
Acin1 (56215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238333 AGGATGAGACAGAGCGTAATG pLKO_005 466 CDS 100% 10.800 15.120 N Acin1 n/a
2 TRCN0000238331 GATCGGCCATCTGAAACTAAG pLKO_005 1068 CDS 100% 10.800 15.120 N Acin1 n/a
3 TRCN0000123423 CAAGATCAAATCTCATTGCTT pLKO.1 905 CDS 100% 3.000 2.400 N Acin1 n/a
4 TRCN0000238334 ACCAGTGTCCCACGCTCATTT pLKO_005 2071 3UTR 100% 13.200 9.240 N Acin1 n/a
5 TRCN0000123421 CCTCTGACTGAGAGCCAAATT pLKO.1 1449 CDS 100% 13.200 9.240 N Acin1 n/a
6 TRCN0000238330 TAACATTAGGAGATACCTTAA pLKO_005 679 CDS 100% 10.800 7.560 N Acin1 n/a
7 TRCN0000123420 GCCCAAGTCATTCAAGAGGAA pLKO.1 257 CDS 100% 2.640 1.848 N Acin1 n/a
8 TRCN0000238332 AGGCCAGCTGAAGGAATTATT pLKO_005 842 CDS 100% 15.000 9.000 N Acin1 n/a
9 TRCN0000123419 CCCTCTCCTTTCTTCCTGTTA pLKO.1 1994 3UTR 100% 4.950 2.970 N Acin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.