Transcript: Mouse XM_006519463.2

PREDICTED: Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 13 (Nudt13), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nudt13 (67725)
Length:
2720
CDS:
290..1360

Additional Resources:

NCBI RefSeq record:
XM_006519463.2
NBCI Gene record:
Nudt13 (67725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425407 CTCCTTGCCGAAATCTGAAAT pLKO_005 661 CDS 100% 13.200 18.480 N Nudt13 n/a
2 TRCN0000114159 GCTGGGAGGTTCTTTCATCAA pLKO.1 691 CDS 100% 4.950 6.930 N Nudt13 n/a
3 TRCN0000444464 CCATTGCCCACCACTTGATTA pLKO_005 1296 CDS 100% 13.200 9.240 N Nudt13 n/a
4 TRCN0000419725 CGAGTGTGTCCCTCCAGTAAA pLKO_005 854 CDS 100% 13.200 9.240 N Nudt13 n/a
5 TRCN0000114157 CGGACAGGATTCGCAAAGAAT pLKO.1 550 CDS 100% 5.625 3.938 N Nudt13 n/a
6 TRCN0000114160 CTATGTCACTAAGGCACGATA pLKO.1 367 CDS 100% 4.950 3.465 N Nudt13 n/a
7 TRCN0000114156 GCCTTCTAATGCTCCACCAAA pLKO.1 1483 3UTR 100% 4.950 3.465 N Nudt13 n/a
8 TRCN0000430948 CATCGAGAAGTTGCGGAAGAG pLKO_005 1028 CDS 100% 4.050 2.835 N Nudt13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.