Transcript: Mouse XM_006519472.3

PREDICTED: Mus musculus RIKEN cDNA 4930578I06 gene (4930578I06Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930578I06Rik (67750)
Length:
1106
CDS:
112..1002

Additional Resources:

NCBI RefSeq record:
XM_006519472.3
NBCI Gene record:
4930578I06Rik (67750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519472.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192793 GCATGCTCAATATAGACCAGA pLKO.1 1050 3UTR 100% 2.640 3.696 N 4930578I06Rik n/a
2 TRCN0000202305 GCTTCTACAGTACGAGATCCA pLKO.1 819 CDS 100% 2.640 3.696 N 4930578I06Rik n/a
3 TRCN0000200930 CCATCCATATCCAGATTGCAT pLKO.1 788 CDS 100% 3.000 2.400 N 4930578I06Rik n/a
4 TRCN0000215422 GATTACCAGAAGCAGTTTAAT pLKO.1 394 CDS 100% 15.000 10.500 N 4930578I06Rik n/a
5 TRCN0000216583 GACTATTCCCATAACACTTTC pLKO.1 439 CDS 100% 10.800 7.560 N 4930578I06Rik n/a
6 TRCN0000191875 GAAAGCCAAAGCTAAGAAGTA pLKO.1 981 CDS 100% 4.950 3.465 N 4930578I06Rik n/a
7 TRCN0000192912 GAAGCCATCCATATCCAGATT pLKO.1 784 CDS 100% 4.950 3.465 N 4930578I06Rik n/a
8 TRCN0000202475 GTGAAGCCATCCATATCCAGA pLKO.1 782 CDS 100% 2.640 1.848 N 4930578I06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519472.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.