Transcript: Mouse XM_006519703.3

PREDICTED: Mus musculus ubiquitin specific peptidase 54 (Usp54), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp54 (78787)
Length:
6926
CDS:
1000..5937

Additional Resources:

NCBI RefSeq record:
XM_006519703.3
NBCI Gene record:
Usp54 (78787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030910 CCCTCTGTAACCAGGCTATTT pLKO.1 1565 CDS 100% 13.200 9.240 N Usp54 n/a
2 TRCN0000037263 CCAGACTTCATTGACTTCAAA pLKO.1 4323 CDS 100% 5.625 3.938 N Usp54 n/a
3 TRCN0000037259 CCCAACTTACACTCTTTGTTT pLKO.1 6530 3UTR 100% 5.625 3.938 N Usp54 n/a
4 TRCN0000030913 GTAGGAATGATCTGTTACTAT pLKO.1 1876 CDS 100% 5.625 3.938 N Usp54 n/a
5 TRCN0000030909 GCACCACAGATTATCACGATT pLKO.1 1723 CDS 100% 4.950 3.465 N Usp54 n/a
6 TRCN0000037262 GCCAGATATGTACCAAGGAAA pLKO.1 4704 CDS 100% 4.950 3.465 N Usp54 n/a
7 TRCN0000037260 CCAGGATAGAAGTTTGCCAAA pLKO.1 4467 CDS 100% 4.050 2.835 N Usp54 n/a
8 TRCN0000030912 GCTCTGGCAAAGACTTTCCAA pLKO.1 1303 CDS 100% 3.000 2.100 N Usp54 n/a
9 TRCN0000037261 CCCTTAGGTCAACTTGGAATT pLKO.1 5720 CDS 100% 0.000 0.000 N Usp54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.