Transcript: Mouse XM_006520011.3

PREDICTED: Mus musculus UDP glycosyltransferases 3 family, polypeptide A1 (Ugt3a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ugt3a1 (105887)
Length:
2127
CDS:
403..1587

Additional Resources:

NCBI RefSeq record:
XM_006520011.3
NBCI Gene record:
Ugt3a1 (105887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093993 CCAGTCATTATATACTGATGA pLKO.1 228 5UTR 100% 4.950 6.930 N Ugt3a1 n/a
2 TRCN0000093989 CCTTCCATAATTCAGTACATA pLKO.1 1647 3UTR 100% 5.625 3.938 N Ugt3a1 n/a
3 TRCN0000093991 GCGGACTTATGCAGTCACTTA pLKO.1 364 5UTR 100% 4.950 3.465 N Ugt3a1 n/a
4 TRCN0000093992 GCAGCACATCTCAAGCCATAT pLKO.1 1417 CDS 100% 10.800 5.400 Y Ugt3a1 n/a
5 TRCN0000110410 GCATGATTCAGTCCAAGGAAA pLKO.1 929 CDS 100% 4.950 2.475 Y Ugt3a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.