Transcript: Mouse XM_006520025.3

PREDICTED: Mus musculus myosin X (Myo10), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo10 (17909)
Length:
6556
CDS:
989..5248

Additional Resources:

NCBI RefSeq record:
XM_006520025.3
NBCI Gene record:
Myo10 (17909)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305940 AGTATCTGCAGGGCGACTATA pLKO_005 4578 CDS 100% 13.200 18.480 N Myo10 n/a
2 TRCN0000306003 CAAGCTCATGAAAGCGTATAT pLKO_005 5161 CDS 100% 13.200 18.480 N Myo10 n/a
3 TRCN0000305938 TGCGTCACACTGCCCTATTTC pLKO_005 2585 CDS 100% 13.200 18.480 N Myo10 n/a
4 TRCN0000375033 GACTATGACCAGGACGATTAC pLKO_005 2339 CDS 100% 10.800 15.120 N Myo10 n/a
5 TRCN0000110605 GCAGGTCTATGACGCTTCTAA pLKO.1 1180 CDS 100% 5.625 7.875 N Myo10 n/a
6 TRCN0000110607 GCCAACACGTACAAGATCGTA pLKO.1 5090 CDS 100% 3.000 4.200 N Myo10 n/a
7 TRCN0000379126 TGATTGTGAAGAAGCGCTATA pLKO_005 5187 CDS 100% 10.800 8.640 N Myo10 n/a
8 TRCN0000110608 CGTGGAGTTTGCGTTTATGTT pLKO.1 4474 CDS 100% 5.625 3.938 N Myo10 n/a
9 TRCN0000110609 CTTAGGCTACTTGGCACGAAA pLKO.1 1318 CDS 100% 4.950 3.465 N Myo10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.