Transcript: Mouse XM_006520032.3

PREDICTED: Mus musculus catenin (cadherin associated protein), delta 2 (Ctnnd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctnnd2 (18163)
Length:
5636
CDS:
303..3968

Additional Resources:

NCBI RefSeq record:
XM_006520032.3
NBCI Gene record:
Ctnnd2 (18163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083313 GCAGTATTGTTCGTTCTGATA pLKO.1 4701 3UTR 100% 4.950 6.930 N CTNND2 n/a
2 TRCN0000097771 CCAGGCTTAAACACCTCCAAT pLKO.1 399 CDS 100% 4.950 3.960 N Ctnnd2 n/a
3 TRCN0000097774 CCTGAAGTGATACAGATGTTA pLKO.1 1947 CDS 100% 5.625 3.938 N Ctnnd2 n/a
4 TRCN0000097772 CCGTCCTTACAGTGAACTGAA pLKO.1 3902 CDS 100% 4.950 3.465 N Ctnnd2 n/a
5 TRCN0000097770 CGCTTTGTTTACTCTCTTCAT pLKO.1 4379 3UTR 100% 4.950 3.465 N Ctnnd2 n/a
6 TRCN0000097773 GCCTGAAGTGATACAGATGTT pLKO.1 1946 CDS 100% 4.950 3.465 N Ctnnd2 n/a
7 TRCN0000083317 CCTCTTCAGGATGATCGGAAA pLKO.1 2379 CDS 100% 4.050 2.835 N CTNND2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.