Transcript: Mouse XM_006520053.3

PREDICTED: Mus musculus triple functional domain (PTPRF interacting) (Trio), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trio (223435)
Length:
11205
CDS:
180..9374

Additional Resources:

NCBI RefSeq record:
XM_006520053.3
NBCI Gene record:
Trio (223435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254108 ACACTTAACTCTTCGTGAAAT pLKO_005 10438 3UTR 100% 13.200 18.480 N Trio n/a
2 TRCN0000265457 ATCGTGCCGAAGCGCTGTAAT pLKO_005 6471 CDS 100% 13.200 18.480 N Trio n/a
3 TRCN0000254107 TCGACCTATCCGTAGCATTAA pLKO_005 9317 CDS 100% 13.200 18.480 N Trio n/a
4 TRCN0000196751 GATGAAATGTAGGCCTTACTT pLKO.1 9973 3UTR 100% 5.625 7.875 N TRIO n/a
5 TRCN0000297115 GATGAAATGTAGGCCTTACTT pLKO_005 9973 3UTR 100% 5.625 7.875 N TRIO n/a
6 TRCN0000254106 ACGTACACAAACGCAGATAAA pLKO_005 1920 CDS 100% 13.200 9.240 N Trio n/a
7 TRCN0000254105 TACGCCTCTCAGCAGATTAAG pLKO_005 1302 CDS 100% 13.200 9.240 N Trio n/a
8 TRCN0000196770 GATTCCAACAAATCGAGTAAA pLKO.1 3813 CDS 100% 13.200 7.920 N TRIO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.