Transcript: Mouse XM_006520289.2

PREDICTED: Mus musculus TRIO and F-actin binding protein (Triobp), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Triobp (110253)
Length:
2680
CDS:
16..2010

Additional Resources:

NCBI RefSeq record:
XM_006520289.2
NBCI Gene record:
Triobp (110253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090846 CCAGGCTACATCTCGCAGGAA pLKO.1 1222 CDS 100% 0.880 1.232 N Triobp n/a
2 TRCN0000090844 GCCATGAAGAAGGCGTATCAA pLKO.1 1396 CDS 100% 5.625 4.500 N Triobp n/a
3 TRCN0000335270 GCCATGAAGAAGGCGTATCAA pLKO_005 1396 CDS 100% 5.625 4.500 N Triobp n/a
4 TRCN0000090845 GACGGATTCAAGCCTCAAATA pLKO.1 354 CDS 100% 13.200 9.240 N Triobp n/a
5 TRCN0000335268 GACGGATTCAAGCCTCAAATA pLKO_005 354 CDS 100% 13.200 9.240 N Triobp n/a
6 TRCN0000090843 CCTTGCACCTTCTTCAGGATT pLKO.1 2272 3UTR 100% 4.950 3.465 N Triobp n/a
7 TRCN0000335330 CCTTGCACCTTCTTCAGGATT pLKO_005 2272 3UTR 100% 4.950 3.465 N Triobp n/a
8 TRCN0000090847 GAAGGAGAATGAACTCCAGTA pLKO.1 1779 CDS 100% 4.050 2.835 N Triobp n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2163 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.