Transcript: Mouse XM_006520486.4

PREDICTED: Mus musculus potassium inwardly-rectifying channel, subfamily J, member 4 (Kcnj4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Kcnj4 (16520)
Length:
7039
CDS:
1488..2825

Additional Resources:

NCBI RefSeq record:
XM_006520486.4
NBCI Gene record:
Kcnj4 (16520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520486.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069763 CCATCATCATAGTGCATGAAA pLKO.1 2257 CDS 100% 5.625 7.875 N Kcnj4 n/a
2 TRCN0000069765 CCACTGGACAATATTTCCTAT pLKO.1 2784 CDS 100% 4.950 6.930 N Kcnj4 n/a
3 TRCN0000069767 CGGCCAGTGTAACGTCTACTT pLKO.1 1562 CDS 100% 4.950 6.930 N Kcnj4 n/a
4 TRCN0000069766 GCGCTATATGCTCATGATCTT pLKO.1 1652 CDS 100% 4.950 6.930 N Kcnj4 n/a
5 TRCN0000069764 CCAGCTCATCAAACCCTACAT pLKO.1 2147 CDS 100% 4.950 3.465 N Kcnj4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520486.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.