Transcript: Mouse XM_006520655.1

PREDICTED: Mus musculus sodium channel, voltage-gated, type VIII, alpha (Scn8a), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scn8a (20273)
Length:
11203
CDS:
149..5962

Additional Resources:

NCBI RefSeq record:
XM_006520655.1
NBCI Gene record:
Scn8a (20273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520655.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366250 TTGTCCTGAACACACTATTTA pLKO_005 2430 CDS 100% 15.000 21.000 N Scn8a n/a
2 TRCN0000366185 AGGACTTTGACCCGTACTATT pLKO_005 393 CDS 100% 13.200 18.480 N Scn8a n/a
3 TRCN0000069058 CCGTACTATTTGACGCAGAAA pLKO.1 404 CDS 100% 4.950 6.930 N Scn8a n/a
4 TRCN0000374810 TGCCTTGAGACACTACTATTT pLKO_005 4741 CDS 100% 13.200 10.560 N Scn8a n/a
5 TRCN0000366251 TTTCGTAGACTTAGCCATAAC pLKO_005 2401 CDS 100% 10.800 8.640 N Scn8a n/a
6 TRCN0000366249 CTTCGACTGGGAGGAGTATAT pLKO_005 1045 CDS 100% 13.200 9.240 N Scn8a n/a
7 TRCN0000366186 CACTCGGTCAATGCAACTTAG pLKO_005 6208 3UTR 100% 10.800 7.560 N Scn8a n/a
8 TRCN0000069059 GCTGATGAAGTGAAACCTTTA pLKO.1 3224 CDS 100% 10.800 7.560 N Scn8a n/a
9 TRCN0000069061 GCTGGTATAAGTTTGCCAATA pLKO.1 2307 CDS 100% 10.800 7.560 N Scn8a n/a
10 TRCN0000069062 CCTGCTCTTTGCCTTAATGAT pLKO.1 4936 CDS 100% 5.625 3.938 N Scn8a n/a
11 TRCN0000069060 CCGATGGAAGAACGTCAAGAT pLKO.1 4180 CDS 100% 4.950 3.465 N Scn8a n/a
12 TRCN0000374811 GAAGCAGAAAGCATCACTTTA pLKO_005 6331 3UTR 100% 13.200 7.920 N Scn8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520655.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.