Transcript: Mouse XM_006520665.3

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 1 (St3gal1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal1 (20442)
Length:
5873
CDS:
1078..2091

Additional Resources:

NCBI RefSeq record:
XM_006520665.3
NBCI Gene record:
St3gal1 (20442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520665.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018822 CGATGGTGACTTCGAGTACAA pLKO.1 2016 CDS 100% 4.950 6.930 N St3gal1 n/a
2 TRCN0000292878 CGATGGTGACTTCGAGTACAA pLKO_005 2016 CDS 100% 4.950 6.930 N St3gal1 n/a
3 TRCN0000018826 GCCAGGACAAGGTATCATATT pLKO.1 1265 CDS 100% 13.200 9.240 N St3gal1 n/a
4 TRCN0000292879 GCCAGGACAAGGTATCATATT pLKO_005 1265 CDS 100% 13.200 9.240 N St3gal1 n/a
5 TRCN0000018823 CCAGCGCTTCAACAAGACTAT pLKO.1 1293 CDS 100% 4.950 3.465 N St3gal1 n/a
6 TRCN0000292880 CCAGCGCTTCAACAAGACTAT pLKO_005 1293 CDS 100% 4.950 3.465 N St3gal1 n/a
7 TRCN0000018825 GACACCGTCAAGGAACTGTTT pLKO.1 1411 CDS 100% 4.950 3.465 N St3gal1 n/a
8 TRCN0000292812 GACACCGTCAAGGAACTGTTT pLKO_005 1411 CDS 100% 4.950 3.465 N St3gal1 n/a
9 TRCN0000018824 GCAAAGGAAATTGGCACCATT pLKO.1 1946 CDS 100% 4.950 3.465 N St3gal1 n/a
10 TRCN0000035549 GCCTTCATCAAGTATGTCTTT pLKO.1 1816 CDS 100% 4.950 3.465 N ST3GAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520665.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.