Transcript: Mouse XM_006520694.2

PREDICTED: Mus musculus tensin 2 (Tns2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tns2 (209039)
Length:
4604
CDS:
66..4199

Additional Resources:

NCBI RefSeq record:
XM_006520694.2
NBCI Gene record:
Tns2 (209039)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025683 CCTAGCAAAGATCCTCTAGAA pLKO.1 3705 CDS 100% 4.950 3.960 N Tns2 n/a
2 TRCN0000362028 GTCATCGTCTCTGCTTATATG pLKO_005 714 CDS 100% 13.200 9.240 N Tns2 n/a
3 TRCN0000361981 TTGTCCCACTGAGCCCTATTT pLKO_005 3614 CDS 100% 13.200 9.240 N Tns2 n/a
4 TRCN0000362035 AGAACAGCTGGTCCGCCATTT pLKO_005 3554 CDS 100% 10.800 7.560 N Tns2 n/a
5 TRCN0000361979 TCCCTCTGTCTCCGTGGATTA pLKO_005 1307 CDS 100% 10.800 7.560 N Tns2 n/a
6 TRCN0000025680 GTCACCTTCATCACCAAAGTT pLKO.1 4158 CDS 100% 5.625 3.938 N Tns2 n/a
7 TRCN0000025679 CCTCAAGATCTACCAGTCTAT pLKO.1 968 CDS 100% 4.950 3.465 N Tns2 n/a
8 TRCN0000025681 GAGGAAATTCTGTGAGGACAA pLKO.1 788 CDS 100% 4.050 2.835 N Tns2 n/a
9 TRCN0000025682 GCCCTGGTAACCTATGGCTAT pLKO.1 2349 CDS 100% 4.050 2.835 N Tns2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.