Transcript: Mouse XM_006520759.3

PREDICTED: Mus musculus RIKEN cDNA E430025E21 gene (E430025E21Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Washc5 (223593)
Length:
3916
CDS:
428..3610

Additional Resources:

NCBI RefSeq record:
XM_006520759.3
NBCI Gene record:
Washc5 (223593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264509 CATCGCTCCTTTGAGTATATA pLKO_005 2384 CDS 100% 15.000 21.000 N Washc5 n/a
2 TRCN0000264510 ATGTACCAATCCACTCATATA pLKO_005 2528 CDS 100% 13.200 18.480 N Washc5 n/a
3 TRCN0000264507 CTCCTCATGCAACGTGCATTT pLKO_005 3682 3UTR 100% 10.800 15.120 N Washc5 n/a
4 TRCN0000192947 GCTCTCAACTGTCTAAATCAT pLKO.1 3740 3UTR 100% 5.625 4.500 N Washc5 n/a
5 TRCN0000201749 GCTAAACTCTTCCTGTCGATT pLKO.1 3022 CDS 100% 4.950 3.960 N Washc5 n/a
6 TRCN0000192560 GAAAGATACTTGACTCCTCAT pLKO.1 3669 3UTR 100% 4.050 3.240 N Washc5 n/a
7 TRCN0000264511 TGCTTACCTGGAGGCTATAAT pLKO_005 2956 CDS 100% 15.000 10.500 N Washc5 n/a
8 TRCN0000264508 ACGAAGCGCTTACCCTATTTC pLKO_005 3227 CDS 100% 13.200 9.240 N Washc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.