Transcript: Mouse XM_006520768.3

PREDICTED: Mus musculus potassium channel, subfamily K, member 9 (Kcnk9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnk9 (223604)
Length:
7933
CDS:
982..2796

Additional Resources:

NCBI RefSeq record:
XM_006520768.3
NBCI Gene record:
Kcnk9 (223604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069315 CGTGAAAGTGATGATGCCCAA pLKO.1 1411 CDS 100% 2.160 3.024 N Kcnk9 n/a
2 TRCN0000069363 GCGGAGATTCTTGCTGGAAAT pLKO.1 2368 CDS 100% 10.800 7.560 N LOC239526 n/a
3 TRCN0000069317 GTCTGGTCCAACTTCCCTTTA pLKO.1 1547 CDS 100% 10.800 7.560 N Kcnk9 n/a
4 TRCN0000069366 GCGCAACACTGAAGTTTCTAT pLKO.1 2034 CDS 100% 5.625 3.938 N LOC239526 n/a
5 TRCN0000069365 CCTGCTGAAACGTATCAAGAA pLKO.1 2001 CDS 100% 4.950 3.465 N LOC239526 n/a
6 TRCN0000069364 GCTTCATAACATTGACTACTA pLKO.1 2165 CDS 100% 4.950 3.465 N LOC239526 n/a
7 TRCN0000069367 GCCTTCTGTATGTTCTACGCT pLKO.1 1909 CDS 100% 0.750 0.525 N LOC239526 n/a
8 TRCN0000069316 GAGGAGAAACTTAAAGCCGAA pLKO.1 1699 CDS 100% 2.160 1.296 N Kcnk9 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7070 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.