Transcript: Mouse XM_006521017.3

PREDICTED: Mus musculus ATP-binding cassette, sub-family D (ALD), member 2 (Abcd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcd2 (26874)
Length:
6430
CDS:
897..3119

Additional Resources:

NCBI RefSeq record:
XM_006521017.3
NBCI Gene record:
Abcd2 (26874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281572 CATCATTGGCAAGCGTTTAAA pLKO_005 1010 CDS 100% 15.000 21.000 N Abcd2 n/a
2 TRCN0000413626 CATCATTGGCAAGCGTTTAAA pLKO_005 1010 CDS 100% 15.000 21.000 N ABCD2 n/a
3 TRCN0000262962 TTTCGCAAATCAGACTTATTA pLKO_005 1457 CDS 100% 15.000 21.000 N Abcd2 n/a
4 TRCN0000105349 TCGGACTTTCATCATCAAATT pLKO.1 1316 CDS 100% 13.200 18.480 N Abcd2 n/a
5 TRCN0000105347 CGCTTAGTAGACCATGCCTAT pLKO.1 1428 CDS 100% 4.050 5.670 N Abcd2 n/a
6 TRCN0000059451 CGGACTTTCATCATCAAATTA pLKO.1 1317 CDS 100% 15.000 10.500 N ABCD2 n/a
7 TRCN0000262965 GGAGCAGCTGTGGACTAATTA pLKO_005 1951 CDS 100% 15.000 10.500 N Abcd2 n/a
8 TRCN0000262964 AGCATGGCTGGACAAGTATAA pLKO_005 3648 3UTR 100% 13.200 9.240 N Abcd2 n/a
9 TRCN0000262963 TGGACACTGCTATCCGTTTAA pLKO_005 2959 CDS 100% 13.200 9.240 N Abcd2 n/a
10 TRCN0000105345 CCCACCTTACATGAAGCAATA pLKO.1 5158 3UTR 100% 10.800 7.560 N Abcd2 n/a
11 TRCN0000105346 CCTCGGACTTTCATCATCAAA pLKO.1 1314 CDS 100% 5.625 3.938 N Abcd2 n/a
12 TRCN0000105348 GCAGGTTATACTGCTAGAGTA pLKO.1 2148 CDS 100% 4.950 3.465 N Abcd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.