Transcript: Mouse XM_006521054.3

PREDICTED: Mus musculus zinc finger protein 385A (Zfp385a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp385a (29813)
Length:
2287
CDS:
144..1187

Additional Resources:

NCBI RefSeq record:
XM_006521054.3
NBCI Gene record:
Zfp385a (29813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194583 CGAAGAGTCAAAGGCATCGAA pLKO.1 324 CDS 100% 3.000 4.200 N Zfp385a n/a
2 TRCN0000240780 CTGCAATGTCAAGGTCAATTC pLKO_005 821 CDS 100% 10.800 8.640 N Zfp385a n/a
3 TRCN0000240782 TCTGTCAGATCCGCTTCAATT pLKO_005 259 CDS 100% 13.200 9.240 N Zfp385a n/a
4 TRCN0000240779 ACCAAGGAGATGCCCTCATAG pLKO_005 1804 3UTR 100% 10.800 7.560 N Zfp385a n/a
5 TRCN0000240783 AGGCGCACTACAAGGGTAATC pLKO_005 295 CDS 100% 10.800 7.560 N Zfp385a n/a
6 TRCN0000134534 GCACATAACAAAGGTACTAAG pLKO.1 678 CDS 100% 10.800 7.560 N ZNF385A n/a
7 TRCN0000240781 GCACATAACAAAGGTACTAAG pLKO_005 678 CDS 100% 10.800 7.560 N Zfp385a n/a
8 TRCN0000138404 CCAGCTTGAGGCACATAACAA pLKO.1 668 CDS 100% 5.625 3.938 N ZNF385A n/a
9 TRCN0000137258 GAGGCACATAACAAAGGTACT pLKO.1 675 CDS 100% 4.050 2.835 N ZNF385A n/a
10 TRCN0000137159 GATCTGCAATGTCAAGGTCAA pLKO.1 818 CDS 100% 4.050 2.835 N ZNF385A n/a
11 TRCN0000173880 GCTGACTTTCTCAAAGGAGCT pLKO.1 962 CDS 100% 2.160 1.512 N Zfp385a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.