Transcript: Mouse XM_006521075.3

PREDICTED: Mus musculus syntabulin (syntaxin-interacting) (Sybu), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sybu (319613)
Length:
3231
CDS:
912..2540

Additional Resources:

NCBI RefSeq record:
XM_006521075.3
NBCI Gene record:
Sybu (319613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191146 CGCTATTTGATTTGCACTATA pLKO.1 2640 3UTR 100% 13.200 18.480 N Sybu n/a
2 TRCN0000191200 CCCGTTCTTATACTAATGGTT pLKO.1 2789 3UTR 100% 3.000 4.200 N Sybu n/a
3 TRCN0000379851 CAAGTTGCCAGATGGGTTATC pLKO_005 1778 CDS 100% 10.800 8.640 N Sybu n/a
4 TRCN0000379443 ATTCAGTCAGCTCGTCATAAA pLKO_005 930 CDS 100% 13.200 9.240 N Sybu n/a
5 TRCN0000379539 CCCAAATCCAGAACAGTATTT pLKO_005 1337 CDS 100% 13.200 9.240 N Sybu n/a
6 TRCN0000201044 CCTCATGAGAGAGCTAGATTT pLKO.1 2264 CDS 100% 13.200 9.240 N Sybu n/a
7 TRCN0000379505 GACGCTCAGCAAGGACGATTA pLKO_005 742 5UTR 100% 10.800 7.560 N Sybu n/a
8 TRCN0000191565 GCTGATAAAGATAAAGGCATT pLKO.1 1599 CDS 100% 4.050 2.835 N Sybu n/a
9 TRCN0000130355 GCAGCTTGGCTGATAAAGATA pLKO.1 1591 CDS 100% 5.625 3.375 N SYBU n/a
10 TRCN0000285504 GCAGCTTGGCTGATAAAGATA pLKO_005 1591 CDS 100% 5.625 3.375 N SYBU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.