Transcript: Mouse XM_006521132.1

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily d, polypeptide 12 (Cyp2d12), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2d12 (380997)
Length:
1519
CDS:
172..1461

Additional Resources:

NCBI RefSeq record:
XM_006521132.1
NBCI Gene record:
Cyp2d12 (380997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219605 ACCTGCGCATGGTGGTAATAG pLKO.1 836 CDS 100% 13.200 9.240 N Cyp2d12 n/a
2 TRCN0000175549 CTTTGTCTTCTCTGCGCAATT pLKO.1 359 CDS 100% 10.800 7.560 N Cyp2d12 n/a
3 TRCN0000174858 GATCAACAGAATGAAGGCAAT pLKO.1 195 CDS 100% 4.050 2.835 N Cyp2d12 n/a
4 TRCN0000174940 GTTATTAACACATTCCCGATA pLKO.1 622 CDS 100% 4.050 2.835 N Cyp2d12 n/a
5 TRCN0000193824 CCATCTTTGAGCATCTTGGTT pLKO.1 269 CDS 100% 3.000 2.100 N Cyp2d12 n/a
6 TRCN0000175422 CTACGTGCAATGTGATTGCAT pLKO.1 497 CDS 100% 0.300 0.180 N Cyp2d12 n/a
7 TRCN0000193228 CAAGAAATCGATGAGGTCATA pLKO.1 952 CDS 100% 4.950 2.475 Y Cyp2d12 n/a
8 TRCN0000126472 CCCTACACCAATGCTGTCATT pLKO.1 1015 CDS 100% 4.950 2.475 Y Cyp2d9 n/a
9 TRCN0000174036 CGCATCACAAGTCGTGACATT pLKO.1 1081 CDS 100% 4.950 2.475 Y Cyp2d12 n/a
10 TRCN0000127173 CTTTGAATATGAAGACCCTTA pLKO.1 537 CDS 100% 4.050 2.025 Y Cyp2d10 n/a
11 TRCN0000126473 GCTTTGAATATGAAGACCCTT pLKO.1 536 CDS 100% 2.640 1.320 Y Cyp2d9 n/a
12 TRCN0000175033 GCTTTGAATATGAAGACCCTT pLKO.1 536 CDS 100% 2.640 1.320 Y Cyp2d12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.