Transcript: Mouse XM_006521196.3

PREDICTED: Mus musculus GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein (Grasp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grasp (56149)
Length:
2299
CDS:
639..1559

Additional Resources:

NCBI RefSeq record:
XM_006521196.3
NBCI Gene record:
Grasp (56149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328793 GGGAGAATACAGGTCACTTAT pLKO_005 1013 CDS 100% 13.200 18.480 N Grasp n/a
2 TRCN0000077723 GCAGGTGGGAAGTATTTATTT pLKO.1 1572 3UTR 100% 15.000 10.500 N Grasp n/a
3 TRCN0000353471 GTGGGCAGGTGGGAAGTATTT pLKO_005 1568 3UTR 100% 13.200 9.240 N Grasp n/a
4 TRCN0000328792 AGGTTCTAACTTTGGAGAAAG pLKO_005 676 CDS 100% 10.800 7.560 N Grasp n/a
5 TRCN0000353441 TGAAAGACCCAAGCATCTATG pLKO_005 1069 CDS 100% 10.800 7.560 N Grasp n/a
6 TRCN0000328849 TGTACCACACGTGCTTCTTTG pLKO_005 1228 CDS 100% 10.800 7.560 N Grasp n/a
7 TRCN0000077725 CCGGGAGATTGTCGATATCAT pLKO.1 881 CDS 100% 5.625 3.938 N Grasp n/a
8 TRCN0000077727 GCCTGCAGTACCTTAAGCAAA pLKO.1 976 CDS 100% 4.950 3.465 N Grasp n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2006 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.