Transcript: Mouse XM_006521221.2

PREDICTED: Mus musculus SH3/ankyrin domain gene 3 (Shank3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shank3 (58234)
Length:
5652
CDS:
150..4988

Additional Resources:

NCBI RefSeq record:
XM_006521221.2
NBCI Gene record:
Shank3 (58234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418782 CCGATACAAGCGGAGAGTTTA pLKO_005 419 CDS 100% 13.200 18.480 N Shank3 n/a
2 TRCN0000423989 GTATGACACCCGGCATGAAAC pLKO_005 1742 CDS 100% 10.800 15.120 N Shank3 n/a
3 TRCN0000082157 GAGGTAATCAAGACCCACAAA pLKO.1 1146 CDS 100% 4.950 6.930 N Shank3 n/a
4 TRCN0000082154 CGAGGTAATCAAGACCCACAA pLKO.1 1145 CDS 100% 4.050 5.670 N Shank3 n/a
5 TRCN0000082155 CCAGCTACACAGCACAGATAA pLKO.1 518 CDS 100% 13.200 9.240 N Shank3 n/a
6 TRCN0000082156 GCCATTATTGCAGGGAACTTT pLKO.1 1116 CDS 100% 5.625 3.938 N Shank3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.