Transcript: Mouse XM_006521242.3

PREDICTED: Mus musculus signal peptide, CUB domain, EGF-like 1 (Scube1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scube1 (64706)
Length:
7862
CDS:
27..2996

Additional Resources:

NCBI RefSeq record:
XM_006521242.3
NBCI Gene record:
Scube1 (64706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109670 CGCCTTAATAGAACATCTAAA pLKO.1 3757 3UTR 100% 13.200 18.480 N Scube1 n/a
2 TRCN0000109672 CCAAATACTACAGGACGGCAA pLKO.1 2099 CDS 100% 2.160 3.024 N Scube1 n/a
3 TRCN0000109673 CACCAGAAGTACGCCTTACAT pLKO.1 828 CDS 100% 5.625 4.500 N Scube1 n/a
4 TRCN0000417213 CCGCTCCAATGAGGGTATGAA pLKO_005 617 CDS 100% 5.625 4.500 N SCUBE1 n/a
5 TRCN0000109674 GTGTGAGAATGACTACTACAA pLKO.1 374 CDS 100% 4.950 3.960 N Scube1 n/a
6 TRCN0000362784 CCTACCCTCTGCCTCTATTTC pLKO_005 3361 3UTR 100% 13.200 9.240 N Scube1 n/a
7 TRCN0000362785 TCAACGAGTGCTTGATGAATA pLKO_005 1081 CDS 100% 13.200 9.240 N Scube1 n/a
8 TRCN0000109671 CCAGATGGAAAGACATGCAAA pLKO.1 1056 CDS 100% 4.950 3.465 N Scube1 n/a
9 TRCN0000056153 TGTGAGAATGACTACTACAAT pLKO.1 375 CDS 100% 5.625 3.938 N SCUBE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.