Transcript: Mouse XM_006521331.2

PREDICTED: Mus musculus zinc finger protein 740 (Zfp740), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp740 (68744)
Length:
3941
CDS:
403..1020

Additional Resources:

NCBI RefSeq record:
XM_006521331.2
NBCI Gene record:
Zfp740 (68744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085714 GACCGATTACTCAGACACAAA pLKO.1 946 CDS 100% 4.950 6.930 N Zfp740 n/a
2 TRCN0000302240 GACCGATTACTCAGACACAAA pLKO_005 946 CDS 100% 4.950 6.930 N Zfp740 n/a
3 TRCN0000085713 CCCGCCTATTTGAAAGCAAAT pLKO.1 1527 3UTR 100% 1.080 1.512 N Zfp740 n/a
4 TRCN0000302167 CCCGCCTATTTGAAAGCAAAT pLKO_005 1527 3UTR 100% 1.080 1.512 N Zfp740 n/a
5 TRCN0000085715 TGTCTGTGATATGCGTTTCAT pLKO.1 834 CDS 100% 5.625 4.500 N Zfp740 n/a
6 TRCN0000302168 TGTCTGTGATATGCGTTTCAT pLKO_005 834 CDS 100% 5.625 4.500 N Zfp740 n/a
7 TRCN0000085716 TCGGAGCAGTTACCACCTCAA pLKO.1 768 CDS 100% 4.050 2.835 N Zfp740 n/a
8 TRCN0000302166 TCGGAGCAGTTACCACCTCAA pLKO_005 768 CDS 100% 4.050 2.835 N Zfp740 n/a
9 TRCN0000085717 ACAAACGGATGTGCCAAGGAT pLKO.1 962 CDS 100% 3.000 2.100 N Zfp740 n/a
10 TRCN0000311075 TACCAGTGTGAACGATGTCAT pLKO_005 907 CDS 100% 0.000 0.000 N Zfp740 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.