Transcript: Mouse XM_006521557.1

PREDICTED: Mus musculus Moloney leukemia virus 10-like 1 (Mov10l1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mov10l1 (83456)
Length:
4089
CDS:
75..3728

Additional Resources:

NCBI RefSeq record:
XM_006521557.1
NBCI Gene record:
Mov10l1 (83456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052068 CGGTCAAATGAAGATAGATTT pLKO.1 3498 CDS 100% 13.200 18.480 N MOV10L1 n/a
2 TRCN0000097736 CGGTGCATATAACCCATTGTT pLKO.1 3041 CDS 100% 5.625 7.875 N Mov10l1 n/a
3 TRCN0000097735 GCCTCACCCTATGGGCCATTA pLKO.1 3872 3UTR 100% 3.600 5.040 N Mov10l1 n/a
4 TRCN0000097738 CCAGACCACATACTTCTCTTT pLKO.1 482 CDS 100% 4.950 3.465 N Mov10l1 n/a
5 TRCN0000097737 CGCTGCTAGAATACAGTGTTA pLKO.1 3649 CDS 100% 4.950 3.465 N Mov10l1 n/a
6 TRCN0000097739 CCATGCAGAAATCGAGCTGAA pLKO.1 1679 CDS 100% 4.050 2.835 N Mov10l1 n/a
7 TRCN0000197681 CAAAGACTACAGTTGTTGTTT pLKO.1 1471 CDS 100% 5.625 3.938 N A430072C10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.