Transcript: Mouse XM_006521741.1

PREDICTED: Mus musculus CD86 antigen (Cd86), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd86 (12524)
Length:
2680
CDS:
244..1188

Additional Resources:

NCBI RefSeq record:
XM_006521741.1
NBCI Gene record:
Cd86 (12524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419626 CTGAGTGAGCTGGTAGTATTT pLKO_005 406 CDS 100% 13.200 18.480 N Cd86 n/a
2 TRCN0000424554 TGGTTCTGTACGAGCACTATT pLKO_005 446 CDS 100% 13.200 18.480 N Cd86 n/a
3 TRCN0000067937 CCGTTGTGTGTGTTCTGGAAA pLKO.1 896 CDS 100% 4.950 6.930 N Cd86 n/a
4 TRCN0000067934 GCCCATTTACAAAGGCTCAAA pLKO.1 377 CDS 100% 4.950 6.930 N Cd86 n/a
5 TRCN0000067935 CCTCTAAGTTAGAGCGGGATA pLKO.1 1091 CDS 100% 4.050 5.670 N Cd86 n/a
6 TRCN0000432435 TACACAACAGTGTCCATATTT pLKO_005 1316 3UTR 100% 15.000 10.500 N Cd86 n/a
7 TRCN0000067933 CCCAGACTTAAAGAGAACTTT pLKO.1 2461 3UTR 100% 5.625 3.938 N Cd86 n/a
8 TRCN0000067936 CCCGAAACCTAAGAAGATGTA pLKO.1 747 CDS 100% 4.950 3.465 N Cd86 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.