Transcript: Mouse XM_006521816.3

PREDICTED: Mus musculus ubinuclein 1 (Ubn1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubn1 (170644)
Length:
6423
CDS:
832..4239

Additional Resources:

NCBI RefSeq record:
XM_006521816.3
NBCI Gene record:
Ubn1 (170644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176325 CGGATTACACTCACTCTCTTT pLKO.1 967 CDS 100% 4.950 6.930 N Ubn1 n/a
2 TRCN0000341971 CGGATTACACTCACTCTCTTT pLKO_005 967 CDS 100% 4.950 6.930 N Ubn1 n/a
3 TRCN0000173688 CCTGAATTACACCCGTCCAAA pLKO.1 3151 CDS 100% 4.950 3.960 N Ubn1 n/a
4 TRCN0000216969 CCTGTAGCTGTGTCATCAATA pLKO.1 1633 CDS 100% 13.200 9.240 N Ubn1 n/a
5 TRCN0000174841 GCCAAAGAAGAGATTTGTATA pLKO.1 5887 3UTR 100% 13.200 9.240 N Ubn1 n/a
6 TRCN0000341973 GCCAAAGAAGAGATTTGTATA pLKO_005 5887 3UTR 100% 13.200 9.240 N Ubn1 n/a
7 TRCN0000194039 GCCCTCATCTTTAGGAATCTA pLKO.1 6060 3UTR 100% 5.625 3.938 N Ubn1 n/a
8 TRCN0000173593 GCTGGCTCAGTCTCTAAACAT pLKO.1 3544 CDS 100% 5.625 3.938 N Ubn1 n/a
9 TRCN0000342047 GCTGGCTCAGTCTCTAAACAT pLKO_005 3544 CDS 100% 5.625 3.938 N Ubn1 n/a
10 TRCN0000175513 CGGAAGAAATTCCAGTGGAAT pLKO.1 2359 CDS 100% 4.950 3.465 N Ubn1 n/a
11 TRCN0000341972 CGGAAGAAATTCCAGTGGAAT pLKO_005 2359 CDS 100% 4.950 3.465 N Ubn1 n/a
12 TRCN0000017815 GCTCGGAAACTTCACCTCTAT pLKO.1 2116 CDS 100% 4.950 3.465 N UBN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.