Transcript: Mouse XM_006521897.3

PREDICTED: Mus musculus GRAM domain containing 1C (Gramd1c), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gramd1c (207798)
Length:
3618
CDS:
6..1910

Additional Resources:

NCBI RefSeq record:
XM_006521897.3
NBCI Gene record:
Gramd1c (207798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197830 GTTCACTAGCTCACACTTTAT pLKO.1 959 CDS 100% 13.200 18.480 N Gramd1c n/a
2 TRCN0000197382 CGACTACTTCTACACTTTGAA pLKO.1 1208 CDS 100% 5.625 7.875 N Gramd1c n/a
3 TRCN0000219636 AGTTATGACACCGCCCTTATT pLKO.1 1575 CDS 100% 13.200 10.560 N Gramd1c n/a
4 TRCN0000219637 ATAGGACATCAATGCTCATAA pLKO.1 2660 3UTR 100% 13.200 9.240 N Gramd1c n/a
5 TRCN0000179617 GCTGAAGAGCTCACTCATTAT pLKO.1 1829 CDS 100% 13.200 9.240 N GRAMD1C n/a
6 TRCN0000177296 GCCATGTTGTATCTGAATGAA pLKO.1 2489 3UTR 100% 5.625 3.938 N Gramd1c n/a
7 TRCN0000176729 CCAAGATTCCATAGTGATGTT pLKO.1 1802 CDS 100% 4.950 3.465 N Gramd1c n/a
8 TRCN0000197444 CTTTATATCAACCGTGTCTTT pLKO.1 906 CDS 100% 4.950 3.465 N Gramd1c n/a
9 TRCN0000178050 GAGCGAGAGAAATGTGAGAAA pLKO.1 734 CDS 100% 4.950 3.465 N Gramd1c n/a
10 TRCN0000182448 GCTGTTCACTAGCTCACACTT pLKO.1 956 CDS 100% 4.950 3.465 N Gramd1c n/a
11 TRCN0000176671 CCAAAGTAGATGTTACAGGAA pLKO.1 1537 CDS 100% 2.640 1.848 N Gramd1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.