Transcript: Mouse XM_006522095.3

PREDICTED: Mus musculus beta-gamma crystallin domain containing 3 (Crybg3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crybg3 (224273)
Length:
10984
CDS:
617..9475

Additional Resources:

NCBI RefSeq record:
XM_006522095.3
NBCI Gene record:
Crybg3 (224273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250997 TTGGAACCACTCGGGATAAAT pLKO_005 8528 CDS 100% 15.000 21.000 N Crybg3 n/a
2 TRCN0000215438 GCTTATGAAGGTTCCAATTTC pLKO.1 8951 CDS 100% 13.200 18.480 N Crybg3 n/a
3 TRCN0000258143 GGCTATGAGTCGCCTACATTA pLKO_005 6356 CDS 100% 13.200 18.480 N Crybg3 n/a
4 TRCN0000179662 GCGTGACCAATCTTTACTGTT pLKO.1 10069 3UTR 100% 4.950 6.930 N Crybg3 n/a
5 TRCN0000250996 GCACCCAGTGTTGAGTATTAA pLKO_005 10133 3UTR 100% 15.000 10.500 N Crybg3 n/a
6 TRCN0000258148 AGGAACCAGTGTCCAAGTATT pLKO_005 7335 CDS 100% 13.200 9.240 N Crybg3 n/a
7 TRCN0000258140 TGTCTGTCCCTGTAGTATATG pLKO_005 6459 CDS 100% 13.200 9.240 N Crybg3 n/a
8 TRCN0000215437 GAACTTAAAGGTTATCCTTTA pLKO.1 7987 CDS 100% 1.080 0.756 N Crybg3 n/a
9 TRCN0000179955 CCCTCCTAAGATGGACTTAAT pLKO.1 10387 3UTR 100% 13.200 7.920 N Crybg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.