Transcript: Mouse XM_006522237.1

PREDICTED: Mus musculus SID1 transmembrane family, member 1 (Sidt1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sidt1 (320007)
Length:
3679
CDS:
381..2219

Additional Resources:

NCBI RefSeq record:
XM_006522237.1
NBCI Gene record:
Sidt1 (320007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425471 ACGCCCGAAGGGAGCAATTAT pLKO_005 807 CDS 100% 15.000 21.000 N Sidt1 n/a
2 TRCN0000173275 CCTGGAATCTACAACGATCAA pLKO.1 571 CDS 100% 4.950 6.930 N Sidt1 n/a
3 TRCN0000429819 TTACCATGTCTGCCCTAATTA pLKO_005 1403 CDS 100% 15.000 12.000 N Sidt1 n/a
4 TRCN0000217682 GCTCAATCTATGCCCATTATA pLKO.1 3103 3UTR 100% 15.000 10.500 N Sidt1 n/a
5 TRCN0000425563 AGAGCTTGGGACTGAACTAAA pLKO_005 2360 3UTR 100% 13.200 9.240 N Sidt1 n/a
6 TRCN0000173712 CCTCCCATCCTCATAGATATT pLKO.1 2509 3UTR 100% 13.200 9.240 N Sidt1 n/a
7 TRCN0000423397 TTTGCTATGGAATACGGTATT pLKO_005 1314 CDS 100% 10.800 7.560 N Sidt1 n/a
8 TRCN0000194001 GAGGTTTCAGAGGAAATCTAT pLKO.1 719 CDS 100% 5.625 3.938 N Sidt1 n/a
9 TRCN0000193347 CATCCATCAAAGAATCTGTAT pLKO.1 616 CDS 100% 4.950 3.465 N Sidt1 n/a
10 TRCN0000175385 CCGTTATCATTAAAGTGGTGT pLKO.1 316 5UTR 100% 2.640 1.848 N Sidt1 n/a
11 TRCN0000193816 CTGGATTTCTTTGATGACCAT pLKO.1 2088 CDS 100% 2.640 1.848 N Sidt1 n/a
12 TRCN0000142012 GCACCGAGAACATCTACTCTT pLKO.1 189 5UTR 100% 4.950 3.465 N SIDT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.