Transcript: Mouse XM_006522396.3

PREDICTED: Mus musculus transmembrane protein 45a (Tmem45a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem45a (56277)
Length:
1521
CDS:
106..984

Additional Resources:

NCBI RefSeq record:
XM_006522396.3
NBCI Gene record:
Tmem45a (56277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313712 CCTTATCCTCATTGGAGTAAA pLKO_005 795 CDS 100% 13.200 18.480 N Tmem45a n/a
2 TRCN0000313711 ACTCGAACCTGCTACCTTAAC pLKO_005 208 CDS 100% 10.800 15.120 N Tmem45a n/a
3 TRCN0000124596 CGGTCGGGAAATGATTGACAT pLKO.1 528 CDS 100% 4.950 6.930 N Tmem45a n/a
4 TRCN0000313652 TAATGTCTCTCACTGGTATAG pLKO_005 281 CDS 100% 10.800 8.640 N Tmem45a n/a
5 TRCN0000124598 CCCAAATCATATGTTTCACTA pLKO.1 422 CDS 100% 0.000 0.000 N Tmem45a n/a
6 TRCN0000124595 CCTGCCTTGATCTTGCATAAA pLKO.1 328 CDS 100% 13.200 9.240 N Tmem45a n/a
7 TRCN0000313710 CTTTGGGCTACAGGGTATAAC pLKO_005 402 CDS 100% 13.200 9.240 N Tmem45a n/a
8 TRCN0000124597 GCATCAATCCTTATCCTCATT pLKO.1 787 CDS 100% 4.950 3.465 N Tmem45a n/a
9 TRCN0000124594 GCCATGTAATTCAAGACCAAT pLKO.1 1308 3UTR 100% 4.950 3.465 N Tmem45a n/a
10 TRCN0000317236 GCCATGTAATTCAAGACCAAT pLKO_005 1308 3UTR 100% 4.950 3.465 N Tmem45a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.