Transcript: Mouse XM_006522491.3

PREDICTED: Mus musculus receptor transporter protein 4 (Rtp4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rtp4 (67775)
Length:
1712
CDS:
691..1440

Additional Resources:

NCBI RefSeq record:
XM_006522491.3
NBCI Gene record:
Rtp4 (67775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125615 GCAGACATTTCAAGAACTGAT pLKO.1 723 CDS 100% 4.950 3.960 N Rtp4 n/a
2 TRCN0000125614 CCACACATAATGGACCCAATA pLKO.1 1592 3UTR 100% 10.800 7.560 N Rtp4 n/a
3 TRCN0000125617 GAGCCTGCATTTGGATAAGAA pLKO.1 771 CDS 100% 5.625 3.938 N Rtp4 n/a
4 TRCN0000125618 CCTGCATTTGGATAAGAACAT pLKO.1 774 CDS 100% 4.950 3.465 N Rtp4 n/a
5 TRCN0000125616 GCAGTCTAAACTCTCATGGAA pLKO.1 1169 CDS 100% 3.000 2.100 N Rtp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.