Transcript: Mouse XM_006522733.3

PREDICTED: Mus musculus polymerase (DNA directed), theta (Polq), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Polq (77782)
Length:
8105
CDS:
176..7300

Additional Resources:

NCBI RefSeq record:
XM_006522733.3
NBCI Gene record:
Polq (77782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426336 ACGGACTTCTTTAGGTATAAA pLKO_005 2614 CDS 100% 15.000 21.000 N Polq n/a
2 TRCN0000120313 CGGCGGAGTATGAGAACTATT pLKO.1 2222 CDS 100% 13.200 18.480 N Polq n/a
3 TRCN0000429339 TGTTACTGATTCCCAATTAAA pLKO_005 3847 CDS 100% 15.000 12.000 N Polq n/a
4 TRCN0000120315 CCTGGCTGAATGCTGAACTTT pLKO.1 489 CDS 100% 5.625 3.938 N Polq n/a
5 TRCN0000120316 CCAGACTAAGAGTTCTCATAA pLKO.1 2425 CDS 100% 13.200 7.920 N Polq n/a
6 TRCN0000120312 CGGTCCAACAAGGAAGGATTT pLKO.1 7853 3UTR 100% 10.800 6.480 N Polq n/a
7 TRCN0000120314 CCAGGAATCAAAGACGACAAT pLKO.1 6878 CDS 100% 4.950 2.970 N Polq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.