Transcript: Mouse XM_006522851.3

PREDICTED: Mus musculus holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase) (Hlcs), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hlcs (110948)
Length:
5299
CDS:
166..2811

Additional Resources:

NCBI RefSeq record:
XM_006522851.3
NBCI Gene record:
Hlcs (110948)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522851.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076128 GCGCTGAGATAGTACAAATAT pLKO.1 3210 3UTR 100% 15.000 21.000 N Hlcs n/a
2 TRCN0000233104 TGAAGTGGCCCAACGATATTT pLKO_005 2327 CDS 100% 15.000 21.000 N HLCS n/a
3 TRCN0000222684 GCGCCCAATATCTTGCTGTAT pLKO.1 1120 CDS 100% 4.950 6.930 N Hlcs n/a
4 TRCN0000076130 CGAACAGTAATCCTACCATTT pLKO.1 2444 CDS 100% 10.800 8.640 N Hlcs n/a
5 TRCN0000076132 GCATCTATTGTGGGCCTTGAT pLKO.1 2680 CDS 100% 4.950 3.465 N Hlcs n/a
6 TRCN0000222683 GCCGCAGGAAATGGGCTTAAT pLKO.1 2097 CDS 100% 13.200 7.920 N Hlcs n/a
7 TRCN0000045783 CCGCAGGAAATGGGCTTAATA pLKO.1 2098 CDS 100% 15.000 10.500 N HLCS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522851.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.