Transcript: Mouse XM_006522912.1

PREDICTED: Mus musculus phosphoribosylglycinamide formyltransferase (Gart), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gart (14450)
Length:
3436
CDS:
242..3274

Additional Resources:

NCBI RefSeq record:
XM_006522912.1
NBCI Gene record:
Gart (14450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305145 ACCGTCGTCATGGCGAGTAAA pLKO_005 1247 CDS 100% 13.200 18.480 N Gart n/a
2 TRCN0000305083 AGATGTAGATGCCGGACAAAT pLKO_005 3085 CDS 100% 13.200 18.480 N Gart n/a
3 TRCN0000112516 CCTTCCTTTAAGGGTTCAAAT pLKO.1 2999 CDS 100% 13.200 18.480 N Gart n/a
4 TRCN0000374597 GTTTGAGGGAGCCATCTATAG pLKO_005 1474 CDS 100% 10.800 15.120 N Gart n/a
5 TRCN0000112519 GTTGGAGTTTAATTGCCGCTT pLKO.1 1099 CDS 100% 2.160 3.024 N Gart n/a
6 TRCN0000308652 GTTGGAGTTTAATTGCCGCTT pLKO_005 1099 CDS 100% 2.160 3.024 N Gart n/a
7 TRCN0000112517 CCAGGGTAATTAATCACAAAT pLKO.1 2820 CDS 100% 13.200 9.240 N Gart n/a
8 TRCN0000374598 GCTTTAGGACTGCAGGTATTC pLKO_005 1325 CDS 100% 10.800 7.560 N Gart n/a
9 TRCN0000112518 CCTCAGAAGTTTGGAGTAGAT pLKO.1 2324 CDS 100% 4.950 3.465 N Gart n/a
10 TRCN0000308715 CCTCAGAAGTTTGGAGTAGAT pLKO_005 2324 CDS 100% 4.950 3.465 N Gart n/a
11 TRCN0000112515 GCTGGTATAATGCTGACCAAA pLKO.1 1064 CDS 100% 4.950 3.465 N Gart n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.