Transcript: Mouse XM_006523005.1

PREDICTED: Mus musculus cysteine and tyrosine-rich protein 1 (Cyyr1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyyr1 (224405)
Length:
5866
CDS:
712..1209

Additional Resources:

NCBI RefSeq record:
XM_006523005.1
NBCI Gene record:
Cyyr1 (224405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442775 CGTATCCTGGAAATCCAAGGA pLKO_005 1151 CDS 100% 2.640 3.696 N Cyyr1 n/a
2 TRCN0000433688 AGAGCTAGGTGGAGAATTATG pLKO_005 1331 3UTR 100% 13.200 10.560 N Cyyr1 n/a
3 TRCN0000435775 AGACCTGCCACCTCCATACTC pLKO_005 1089 CDS 100% 1.650 1.320 N Cyyr1 n/a
4 TRCN0000413645 GAACTAGAACAGATCGTTATT pLKO_005 1557 3UTR 100% 13.200 9.240 N Cyyr1 n/a
5 TRCN0000124910 CCAGAACAGAATACGTGACAA pLKO.1 1185 CDS 100% 4.950 3.465 N Cyyr1 n/a
6 TRCN0000124912 CCGAAGTTGATCCTGCTCTTT pLKO.1 754 CDS 100% 4.950 3.465 N Cyyr1 n/a
7 TRCN0000124909 CGATAATATCTCAGGCAGAAT pLKO.1 1280 3UTR 100% 4.950 3.465 N Cyyr1 n/a
8 TRCN0000124911 CGTGTTTGGAATCGTGTTCAT pLKO.1 909 CDS 100% 4.950 3.465 N Cyyr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.