Transcript: Mouse XM_006523008.3

PREDICTED: Mus musculus SR-related CTD-associated factor 4 (Scaf4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scaf4 (224432)
Length:
4435
CDS:
455..4087

Additional Resources:

NCBI RefSeq record:
XM_006523008.3
NBCI Gene record:
Scaf4 (224432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523008.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254158 GGTCCAATTGAATCGATTAAT pLKO_005 2246 CDS 100% 15.000 21.000 N Scaf4 n/a
2 TRCN0000265498 TCTACTATCGCTGGTATAAAT pLKO_005 2948 CDS 100% 15.000 21.000 N Scaf4 n/a
3 TRCN0000415295 TTTGGGCCAAGATTCTCTAAA pLKO_005 704 CDS 100% 13.200 18.480 N SCAF4 n/a
4 TRCN0000254160 GAACGGTATGGGAGCCGTAAT pLKO_005 3689 CDS 100% 10.800 15.120 N Scaf4 n/a
5 TRCN0000254159 AGGAATAAAGGCGGATTATAA pLKO_005 2401 CDS 100% 15.000 12.000 N Scaf4 n/a
6 TRCN0000254161 TCCCTGTTCCTGCGCCTATAA pLKO_005 2658 CDS 100% 13.200 10.560 N Scaf4 n/a
7 TRCN0000428259 GTGAACCAGAAATCCATAAAG pLKO_005 2360 CDS 100% 13.200 9.240 N SCAF4 n/a
8 TRCN0000431638 TAATTAGAAGTGCTCTCTATT pLKO_005 4328 3UTR 100% 13.200 9.240 N SCAF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523008.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.